lelgenio@lemmy.ml to Memes@lemmy.ml · 1 year agoAACGTCATAGCCTGATTACCAGTAGGTACTAGlemmy.mlimagemessage-square12fedilinkarrow-up1449arrow-down127file-text
arrow-up1422arrow-down1imageAACGTCATAGCCTGATTACCAGTAGGTACTAGlemmy.mllelgenio@lemmy.ml to Memes@lemmy.ml · 1 year agomessage-square12fedilinkfile-text
An image of Mr Krabs saying “Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG”
minus-squareTauZerolinkfedilinkarrow-up3·1 year agoOut of the loop - what is the joke supposed to be? If this is neither a real sequence nor a hidden message. Is it something Krusty Krab says in the show? Is it just funny because it is absurd?
minus-squareGlifted@lemmy.worldlinkfedilinkarrow-up10·1 year agoIf “reading” the sequence, it sounds similar to Mr Krab’s laugh
minus-squareapotheotic (she/her)@beehaw.orglinkfedilinkarrow-up7·1 year agoMr Krabs laughs very distinctly, and it sort of sounds like it would be spelt like the genome in the OP. Check it out on yt or something, should help
Out of the loop - what is the joke supposed to be? If this is neither a real sequence nor a hidden message. Is it something Krusty Krab says in the show? Is it just funny because it is absurd?
If “reading” the sequence, it sounds similar to Mr Krab’s laugh
Mr Krabs laughs very distinctly, and it sort of sounds like it would be spelt like the genome in the OP. Check it out on yt or something, should help